1

Site directed mutagenesis Grundlagen erklärt

News Discuss 
Non-overlapping primer design ensures robust, exponential amplification, generating a high percentage of desired mutations from a wide Auswahl of templates The sequences of the ColE1 origin primers used hinein two-fragment cloning were GGAGCGAACGACCTACACCGAACTGAGATACCTACAGCG and CGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCC. All primers were ordered as desalted oligonucleotides and used wit... https://site-directed-mutagenesis43187.acidblog.net/52953039/the-ultimate-guide-to-mutagenesis

Comments

    No HTML

    HTML is disabled


Who Upvoted this Story